MISSION® esiRNA

Name	MISSION® esiRNA
Supplier	Sigma-Aldrich
Catalog	EHU114671
Category	siRNA
Prices	$250.00
Sizes	50 µg
Applications	Gene Silencing
Gene	HSP90AA1
Sequence	TGGTGACATCTCCATGCTGTATTGTCACAAGCACATATGGCTGGACAGCAAACATGGAGAGAATCATGAAAGCTCAAGCCCTAAGAGACAACTCAACAATGGGTTACATGGCAGCAAAGAAACACCTGGAGATAAACCCTGACCATTCCATTATTGAGACCTTAAGGCAAAAGGCAGAGGCTGATAAGAACGACAAGTCTGTGAAGGATCTGGTCATCTTGCTTTATGAAACTGCGCTCCTGTCTTCTGGCTTCAGTCTGGAAGATCCCCAGACACATGCTAACAGGATCTACAGGATGATCAAACTTGGTCTGGGTATTGATGAAGATGACCCTACTGCTGATGATACCAGTGCTGCTGTAACTGAAGAAATGCCACCCCTTGAAGGAGATGACGACACATCACGCATGGAAGAAGTAGACTAATCTCTGGCTGAGGGATGACT
Description	MISSION esiRNA are endo-ribonuclease prepared siRNA
Supplier Page	Shop

Product images

<B>Immunoblotting</B><BR/>HSP90AA1: <B>Cat. No. EHU114671</B>: Western blot analysis of HSP90AA1 in HeLa cells.<BR/><B>Lanes</B><BR/>1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, <B>Cat. No. EHURLUC</B>) as negative control.<BR/>2. HeLa cells transfected with HSP90AA1 esiRNA (<B>Cat. No. EHU114671</B>). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Heat shock Protein 90 (1:4000) Clone: AC-16 (<B>Cat. No. H1775</B>) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, an 83% HSP90AA1 protein reduction was measured between the negative control RLUC and the sample treated with HSP90AA1 esiRNA.

Immunoblotting
HSP90AA1: Cat. No. EHU114671: Western blot analysis of HSP90AA1 in HeLa cells.
Lanes
1. HeLa cells transfected with Renilla Luciferase esiRNA (RLUC, Cat. No. EHURLUC) as negative control.
2. HeLa cells transfected with HSP90AA1 esiRNA (Cat. No. EHU114671). Quantitative-Immunoblotting: Lysates were separated on SDS-Page and probed with mouse Monoclonal Anti-Heat shock Protein 90 (1:4000) Clone: AC-16 (Cat. No. H1775) and goat Anti-GAPDH (1:7000) (Acris) antibodies. The signal intensities of indicated bands were quantified using an Odyssey infrared imaging system (Li-COR) and normalized to the GAPDH signal. At 72h post transfection, an 83% HSP90AA1 protein reduction was measured between the negative control RLUC and the sample treated with HSP90AA1 esiRNA.